Transferibilidad de DNA en Lactobacillus: ¿hay riesgo de transferencia horizontal desde la microbiota a probióticos y viceversa?

Joaquina Fina Martin, María Mercedes Palomino, Carmen Sánchez Rivas, Sandra M. Ruzal y Mariana C. Allievi

Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales-UBA, IQUIBICEN-CONICET

mallievi@qb.fcen.uba.ar

Versión para imprimir

Recibido: 27/02/2017 - Aceptado: 05/04/2017

Resumen

Con el objetivo de estudiar si la cepa probiótica Lactobacillus casei BL23 puede ser receptora de genes ya sea de virulencia o de resistencias a antibióticos de otras especies de su entorno, lo que pondría en alerta sus propiedades benéficas, se evaluó la expresión del gen comX anotado como factor sigma alternativo de la RNA polimerasa, P_001986877.1, Gene ID: 6404650, presente en esta cepa. Esta función, como en otras bacterias lácticas, podría cumplir un rol como elemento regulador de la cascada de competencia que permite la adquisición de DNA exógeno. Para ello se analizaron si en las condiciones del ambiente intestinal esta cepa es capaz de modificar la expresión génica del gen comX, Se testearon condiciones que emulan el tracto gastrointestinal, como estrés salino o pH ácido con sales biliares, y se las comparó con aquellas condiciones que promueven la expresión de los genes de competencia, como el hambreado, la irradiación con luz UV y la exposición al calor. Se analizó por Dot Blot y qPCR el RNA mensajero del gen comX, evaluándose los niveles de expresión en fases de crecimiento exponencial y estacionaria del gen de interés y del gen constitutivo 16S rRNA. También se analizó la transferencia de un marcador de resistencia a antibiótico (CmR) evaluando así la transformación natural en cada uno de las condiciones anteriores por medio de la técnica de número más probable (NMP). Los resultados mostraron un aumento en la expresión del gen comX en condición de irradiación con luz UV o pH ácido con sales biliares. Sin embargo, el número de transformantes obtenidos mediante NMP no es significativamente diferente respecto de las condiciones no-inducidas. Estos resultados apoyarían la hipótesis que los Lactobacilos utilizados como probióticos no son naturalmente transformables y se discuten diferentes hipótesis en cuanto a la presencia de funciones CRISP-cas, la respuesta SOS y la capacidad recombinogénica de esta cepa

Palabras clave: Competencia Natural, Lactobacillus casei, transferibilidad

Summary

Transference of genes in Lactobacillus: Is there a risk of horizontal transfer from microbiota to probiotic strains and viceversa?

In order to determine the capacity of the probiotic strain Lactobacillus casei BL23 to acquire virulence or antibiotic resistance genes from its environment, thecomX gene present in this strain (alternative sigma factor of the RNA polymerase P_001986877.1, Gene ID: 6404650), was examined in competence and transformation experiments.In a first approach the presence and transcription activity was determined in conditions known to induce competence in other bacteria (heat, UV irradiation or starvation) and in those present in the intestinal tract (saline stress, acidic pH, presence of bile salts). Messenger RNA ofcomX gene, was analyzed byDot Blot andqPCR and related to their expression in early stationary phase growth condition and to the housekeeping gene 16S rRNA. The results showed an increase in the expression ofcomX in the condition of UV and acid pH with bile salts. The transfer of an antibiotic resistance marker (CmR), present in a replicative plasmid, was determined in all these conditions by evaluating the most probable number (MPN). In all the conditions assayed, the number of transformants was not significantly different from control in non-induced condition and from the mutation frequency. Although an induction of expression ofcomX was observed it was not enough to supply competence for plasmid or chromosomal transformation. These results argue in favor of the absence of transformability ofLactobacilli although it is not sufficient to ensure the total absence of transfer mechanisms in these bacteria. Discussion is focused on the recombining capacity of this strain, the presence prophages, and the role of SOS and CRISPR-cas functions.

Keywords: Natural Competence, Lactoacillus casei, transferability.

Introducción

Entre las bacterias probióticas que actualmente se encuentran disponibles en la industria láctea varias pertenecen al género Lactobacillus. Los probióticos son microorganismos vivos que cuando son ingeridos en la dieta y administrados en las cantidades adecuadas confieren beneficios para la salud del consumidor. Están considerados microorganismos GRAS (Generalmente reconocidos como seguros) and QPS (presunción calificada de estado seguro) por su larga historia de uso seguro. Las cepas probióticas de Lactobacillus solo excepcionalmente transfieren resistencia a antibióticos. Sin embargo, no se han realizado estudios sistematizados de transferibilidad. La transferencia de resistencia a antibióticos es la única causa relevante de prudencia ya que podría potencialmente servir como anfitriones de esos genes para luego transferirlos a otras bacterias. De hecho, es la única razón relevante por la cual los microorganismos genéticamente modificados no son aprobados para su uso en alimentos, ya que podrían experimentar transferencia horizontal de genes con la microbiota autóctona, sin embargo este proceso nunca ha sido claramente establecido. Los Lactobacilos son capaces de sobrevivir en el tránsito por el tracto gastrointestinal y colonizar el intestino de manera transitoria. En ese ambiente hay múltiples condiciones de estrés con las cuales se enfrenta

Los Lactobacillus se encuentran comúnmente en las cavidades oral, vaginal y regiones intestinales de muchos animales. Son microorganismos industrialmente importantes que contribuyen a la producción de alimentos funcionales entre los cuales se encuentran los probióticos definidos como “microorganismos vivos que ejercen una acción benéfica sobre la salud del huésped al ser administrados en cantidades adecuadas más allá de los efectos nutricionales habituales” (FDA-OMS). Diversos grupos en el mundo han probado que productos alimenticios conteniendo probióticos producen un efecto positivo en la salud tanto a nivel gastrointestinal como en la cavidad oral. Este efecto incluye la modulación y desarrollo del sistema inmune, acción antitumoral y actividades bioquímicas metabólicas en el intestino, limitación del crecimiento y de la colonización de bacterias patógenas. La producción de ácido láctico (que resulta en una reducción del pH local) y la adhesión competitiva o el desplazamiento de las bacterias patógenas se han citado con mayor frecuencia en la literatura [1-7]. También, las cepas de L. acidophilus presentan una envoltura proteica o S-layer que le confieren actividad antimicrobiana para cepas patógenes comoS. aureus [8-10] y antivirales [11]. Dada la importancia económica de las BAL (bacterias ácido lácticas), y más recientemente su uso prospectivo como vacunas seguras, se ha estudiado en lactobacilos y lactococos una serie de rasgos fisiológicos, así como herramientas de expresión de grado alimentario [12].

La disponibilidad de secuencias del genoma bacteriano completo ofrece la posibilidad de descubrir las funciones de muchos genes desconocidos o asignársela a aquellos hipotéticos procedentes del alineamiento de secuencias con genes o proteínas de bancos de datos de otros microorganismos. En 2010 se ha dado a conocer la secuencia completa del genoma de Lactobacillus casei cepa BL23 en (L. casei BL23), de características probióticas científicamente documentadas [13] (Accession N° FM 177140.1), y se encuentra disponible en la base de datos del sitio NCBI [14]. La asignación de función que surge del análisis diferencial de secuencias genómicas [15-18] debe ser comprobada experimentalmente. En particular nos enfocaremos a definir en L. casei BL23 los genes relacionados con el estado celular de competencia natural que permiten la adquisición de DNA exógeno y su recombinación o integración al genoma.

La baja eficiencia de transformación de estos microorganismos es uno de los problemas más importantes para fines de estudios científicos. La limitada transformabilidad es en parte consecuencia de su gruesa pared celular, que es altamente resistente, pero también de su deficiente sistema de recombinación. Debido a que las cepas probióticas de Lactobacillus son utilizadas tanto para la producción de cultivos iniciadores o en formulaciones de alimentos funcionales es deseable que no haya riesgos de transferibilidad de resistencia a antibióticos (RA) una vez que se encuentra en el medio gastrointestinal, el cual coloniza. Aunque estas cepas gocen de status GRAS, no se han realizado estudios sistematizados que demuestren que no existe riesgo de transferibilidad de RA. Los datos bibliográficos apoyan la hipótesis de que la ingestión de alimentos conteniendo Lactobacillus no es peligrosa, en particular, la bacteremia causada por lactobacilos es extremadamente rara y sólo se produce en pacientes predispuestos [19, 20].

En contraposición, se ha sugerido que los lactobacilos podrían actuar como reservorios de genes de resistencia a antibióticos [21]. Estos microorganismos tienen una alta resistencia a distintos antibióticos bacitracina, cefoxitina, ciprofloxacina, ácido fusídico, kanamicina, gentamicina, metronidazol, nitrofurantoína, norfloxacina, estreptomicina, sulfadiazina, teicoplanina, trimetoprim / sulfametoxazol, y la vancomicina [22]. En la mayoría de los casos dichas resistencias se deben a características propias. La presencia de plásmidos y de resistencias asociadas es poco frecuente. Por otro lado la mayoría de los estudios con productos lácteos fermentados tienden a establecer los perfiles de resistencia a antibióticos de las poblaciones de Lactobacillus es conociendo la naturaleza de las resistencias.

Las bacterias que son competentes para transformación genética natural son capaces de tomar DNA exógeno del medio ambiente, generalmente con poca o ninguna especificidad. En un segundo paso incorporan en sus genomas por recombinación alguno de los genes. La competencia natural es un proceso transitorio, fuertemente regulado, con la participación de dos conjuntos de genes: los genes de la competencia temprana necesarios para el ingreso de DNA exógeno y tardía responsable de la incorporación a su genoma por alguno de los mecanismos de recombinación. Los sistemas más estudiados de transformación natural en Gram positivas corresponden a los géneros Bacillus [23] y Streptococcus [24].

Hay tres hipótesis que pueden explicar la función evolutiva de la competencia. La primera sugiere el ingreso del DNA como nutriente, donde la expresión de genes de competencia en fase estacionaria y la baja especificidad hacia el DNA ingresante avala esta teoría. La segunda teoría sostiene el rol del DNA exógeno como molde para reparar el cromosoma dañado; la inducción de genes del sistema SOS de reparación del DNA en Bacillus subtilis durante el estado de competencia está en concordancia con la hipótesis. La tercera se sustenta en la transformación como mecanismo de importación de nueva información genética que podría implicar una ventaja adaptativa; el intercambio genético como motor en la evolución y adaptación [24, 25].

Se ha reportado que un aumento en la expresión de comX en Streptococcus thermophilus (S. thermophilus) mejora la eficiencia de transformación natural [26]. ComX (factor sigma alternativo de la RNA polimerasa, YP_001986877.1) parece estar también presente en diferentes especies de BAL, como Lactococcus lactis [27] y Lactobacillus plantarum [15]. La presencia de codificación para el gen comX sugiere que esas bacterias podrían ser naturalmente transformables siempre que puedan identificarse las condiciones de crecimiento que promuevan la competencia, también alternativamente estos genes podrían tener otras funciones o representan reliquias no funcionales heredadas de un ancestro común competente.

Nuestra hipótesis plantea que Lactobacillus casei BL23 si bien presenta genes relacionados con la competencia natural y estos se transcriben, aún en condiciones de sobreexpresión la cepa no sería capaz de incorporar DNA del medio gastrointestinal. Un estudio sistemático que demuestre que no se observan condiciones que promuevan el intercambio genético en el ambiente gastrointestinal constituiría un aval científico para continuar con el grado GRAS y QPS (Qualified presumption of safety status). El objetivo del trabajo es caracterizar posibles funciones de competencia en la cepa probiótica L. casei BL23.

Para este propósito se analizaron las secuencias in silico de genomas completos. Se seleccionó al gen comX por presentar homología con varios factos sigma relacionados con la competencia. Se testearon condiciones que emulan el tracto gastrointestinal, como estrés salino o pH ácido con sales biliares, las cuales fueron comparadas con aquellas condiciones que promueven la expresión de los genes de competencia en bacterias Gram positivas, como el hambreado, la irradiación con luz UV y el calentamiento. Se analizó por Dot Blot y qPCR el RNA mensajero del gen comX.

Materiales y Métodos

Análisis bioinformático

Con el objetivo de hallar funciones relacionadas con la competencia y recombinación lo primero que se realizó fue una búsqueda in silico dentro del genoma de Lactobacillus casei BL23 (accession FM177140.1) utilizando el programa SEED viewer (rast.nmpdr.org/seedviewer.cgi). Para el análisis de porcentaje de GC se utilizó el programa Ensembl Bacteria (www.bacteria.ensembl.org).

La búsqueda de dominios funcionales se realizó utilizando el programa BLAST (ncbi.nlm.nih.gov/BLAST)También se compararon las secuencias proteicas de cepas emparentadas mediante un alineamiento global con los programas ClustalW y Emboss Matcher (www.ebi.ac.uk/Tools/psa/emboss_matcher). Se utilizaron las secuencias aminoacídicas anotadas como ComX de las cepas de Lactobacillus casei BL23 (YP_001986877.1), Lactobacillus casei str. Zhang (YP_003787907.1), Lactobacillus casei ATCC 334 (YP_806109.1), Lactobacillus paracasei subsp. paracasei ATCC 25302 (ZP_03965770.1), Lactobacillus paracasei subsp. paracasei 8700 (ZP_04672250.1). La comparación de la proteína ComX utilizando el programa Emboss Matcher se realizó comparando la secuencia de aminoácidos de ComX de Streptococcus pneumoniae (CVX79751.1).

Condiciones evaluadas para la inducción de competencia natural

Exposición al UV: 150 µl de células crecidas durante la noche fueron irradiaron con UV por un período de 0, 15, 30 y 90 segundos a una distancia de 10 cm. Luego se inocularon en MRS (medio de cultivo de Man, Rogosa y Sharpe) y se verificó el crecimiento por DO550nm.

Hambreado: Se cosechó por centrifugación un cultivo de 3 ml de células crecido durante una noche. A continuación se realizaron dos lavados con solución fisiológica y finalmente se resuspendieron en 0,7 ml de solución fisiológica y se colocaron 2hs a 37ºC. Luego se realizó el recuento de viables en placas de MRS. Calentamiento: Se calentó el cultivo a 50ºC durante 5 minutos. Luego se realizó el recuento de viables en placas de MRS.

Crecimiento en alta sal: se crecen cultivos en MRS conteniendo NaCl 0,9M

Crecimiento en medio ácido con sales biliares: para reproducir la condición del estómago se utilizó MRS ácido a pH 4 y sales biliares en concentración 0,05%.

Análisis de la expresión génica

Real time PCR

La expresión génica de comX se verificó por PCR cuantitativa en tiempo real utilizando el termociclador MyiQTM Real-time (Bio-Rad). Se utilizó el 16S rRNA como gen de referencia.

Se cosecharon por centrifugación 2-3 ml de células crecidas en MRS a una DO550 =0,800 que fueron tratadas o no con las distintas condiciones de inducción de competencia.

Para la extracción de RNA se utilizó el método de fenol caliente [28]. La concentración de la muestra se midió en Nanodrop2000 (Thermo Scientific). En el caso que fuera necesario se realizó una dilución tal para obtener una concentración de RNA de 1 µg/µl. Los primers específicos fueron: directos para el gen 16S rRNA 5’-GCGAAGGCGGCTGTCTGG-3’ y para comX 5`- AATCGAGTTTGCACAGTTTC–3`´. Los primers reversos fueron 16S rRNA, 5’-GGCACTGAAGGGCGGAAACC-3’y para comX5`- CCAGTTGACTTGCTATTCTTCGCG–3`. Para la transcripción reversa se emplearon 7 µg de RNA de cada muestra. El DNAc fue sintetizado empleando 25 pmoles de los primers reversos específicos. Los resultados se analizaron mediante el método del Ciclo Umbral (ΔCT) con el Software IQTM 5 Optical System. Cada muestra se analizó por triplicado de experimentos independientes. La expresión se relativizó siempre a la condición control.

La síntesis de la sonda se realizó por PCR utilizando entre los nucleótidos dCTP biotinilado-dCTP frío, utilizando como primers directo y reverso respectivamente 5`- AGGAGGAGATATGAAAGCCACAG–3` y 5`- CCAGTTGACTTGCTATTCTTCGCG–3`. La sonda biotinilada amplifica la región codificante del gen comX y fue revelada con el sistema de estreptavidina.

Se extrajo RNA y se sembró en una membrana de nylon Hybond-N+ (Amerasham Pharmacia Biotech). Antes de realizar la prehibridización, la membrana se sumergió en buffer citrato de sodio salino (SSC) 6X durante 2 minutos. A continuación se prehibridó con solución de prehibridización la cual contiene SSC 6X, solución de Denhardt (1% de ficol, tipo 400, 1% de polivinilpirrolidona y 1% de seroalbúmina bovina) y SDS 1 % incubando 2 hs. en movimiento a 42ºC. Luego se hibridó con solución de hibridación conteniendo la sonda y buffer SSC 6X, polietilenglicol 4000 5%, buffer fosfato de sodio 20mM pH 7.5 y DNA de esperma de salmón 100 ug/ml incubando toda la noche a 37ºC. Se removió la solución y se lavó con SSC 2X a 0,2X. Luego se reveló con el kit de detección Phototope-Star Kit (BioLabs) siguiendo las indicaciones del fabricante.

Transformación natural in vivo, método del número más probable

Para detectar los eventos de transformación natural in vivo se utilizó el método del número más probable que es una estrategia eficiente de estimación de densidades poblacionales, especialmente cuando una evaluación cuantitativa de células individuales no es factible debido a la baja representatividad.

2 unidades de DO de células (2x108 UFC) tratadas con las distintas condiciones de inducción de competencia y sin tratar (condición control) se pusieron en contacto con 5 µl de plásmido pNZ273 (CmR) [224,7 ng/µl]. Se colocaron a 37º C durante 1 hora. Luego se agregó 1 ml de medio MRS y se llevaron a 37º C por un lapso de 60 minutos.

Posteriormente se realizaron diluciones seriadas al décimo de las células y se inocularon por triplicado las diluciones -1, -2 y -3 y sin diluir en medio MRS Cm [5µg/ml]. Como control de mutantes espontáneas se realizó el mismo procedimiento pero sin poner en contacto las células con el plásmido.

Resultados

Análisis bioinformático

Se analizaron las secuencias in silico de genomas completos. Se observó que L. casei BL23 presenta un conjunto de genes relacionados con la toma del DNA y competencia y también un conjunto de genes implicados en el procesamiento del DNA y el sistema CRISPR (Figura 1).

Como primera aproximación a la asignación de función in silico, de la secuenciación del genoma de L. casei BL23 [14] se ha encontrado la codificación para comX (Gene ID: 6404650).

fig1

Figura 1: Análisis de distribución de subsistemas dentro del genoma. Esquema de los subsistemas presentes en el genoma de L. casei BL23 obtenido del programa Seed viewer.

fig2

Figura 2: Anotación del gen comX en el Seed Viewer dentro del genoma de Lactobacillus casei BL23.(A)La región cromosómica del gen en foco (arriba) en rojo y adyacente un marco de lectura abierto de un elemento genético móvil.(B) El gráfico se centra en el gen comX, numerado con 0 para el genoma de L. casei BL23 y se compara con otros organismos similares. Conjuntos de genes con secuencia similar se agrupan con el mismo número y color. Los genes cuya posición relativa se conserva en al menos otras especies están funcionalmente acoplados y comparten cajas grises de fondo.

Utilizando el mismo programa (http://rast.nmpdr.org/seedviewer.cgi?page=BrowseGenome&organism=543734.3) se analizó la disposición del gen en el genoma y los genes cercanos (Figura 2). Se comparó la ubicación del gen comX en el genoma en relación con otras especies del grupo de BAL. Con excepción de la cepa de L. casei ATCC 334, no se encontró sintenia, es decir, una localización conservada de genes en posiciones equivalentes del genoma en esas especies relacionadas.

Sin embargo, comX se encuentra aledaño al gen que codifica para una transposasa. Esto podría indicar que comX fue adquirido mediante un elemento genético móvil. Al analizar el %GC de dicha región empleando la página del Ensembl Bacteria (www.bacteria.ensembl.org) se observó que el contenido de GC es similar al resto del genoma (46,34 %) en esa posición del cromosoma. Dado que dicho porcentaje es característico para cada organismo, al no verificarse variaciones significativas en esta región para los genes analizados, la hipótesis del origen por un evento de adquisición mediante un transposón pierde fuerza.

El gen comX se postula como un factor sigma alternativo de la RNA polimerasa (YP_001986877.1) La proteína predicha en esa codificación tendría una longitud de 182 aminoácidos. Con el fin de corroborar la probable función descripta, se realizó la búsqueda utilizando el programa BLAST (ncbi.nlm.nih.gov/BLAST). Como se observa en la Figura 3 la secuencia proteica contiene los probable dominios con similitud a diversos factores transcripcionales denominados Sigma70, que le otorga a la RNA polimerasa, la especificidad de reconocimiento a promotores involucrados en respuestas a estrés.

fig3

Figura 3: Esquema de los dominios conservados que presentan similitud con comX.

Un análisis mediante un alineamiento global de proteínas tipo ComX dentro del grupo L. casei muestra un alto porcentaje de similitud (Figura 4)

fig4

Figura 4: Alineamiento múltiple con ClustalW de proteínas anotadas como ComX o factor sigma específico de competencia ComX o factor de la RNA polimerasa sigma-70 dentro del grupo de especies similares a L. casei. YP_001986877.1 L. casei BL23; YP_003787907.1 L. casei Zhang; YP_806109.1 L. casei ATCC 334; ZP_03965770.1 L. paracasei subsp. paracasei ATCC 25302; ZP_04672250.1 L. paracasei subsp. paracasei 8700

S. pneumoniae (Gram positiva) desarrolla competencia natural frente a determinadas condiciones fisiológicas y ambientales y codifica en su genoma para comX. Por ello se realizó un alineamiento global (Figura 5) de secuencias entre S. pneumoniae y L. casei BL23 utilizando el programa Emboss Matcher (www.ebi.ac.uk/Tools/psa/emboss_matcher) para evaluar la similitud e identidad de secuencias aminoacídicas.

fig5

Figura 5: Alineamientos de las secuencias de aminoácidos de la proteína ComX de S. pneumoniae y la de L. casei BL23. Se muestran los resultados obtenidos utilizando una matriz de sustitución Blosum40 (A) y PAM80 (B).

Las proteínas poseen un 45.2% y 43.6% de similitud (Figura 5) cuando se realizó un análisis con una matriz de sustitución Blosum40 y PAM80 respectivamente. Esto indica que ComX de L. casei BL23 presenta un gran parecido con la proteína de S. pneumoniae, lo cual indicaría que a pesar de no tener una función probada ComX podría desempeñar un rol similar al descripto para S. pneumoniae.

Se corroboró la presencia del gen comX mediante amplificación por PCR desde el DNA genómico de L. casei BL23.

Se analizó su expresión en posibles condiciones de inducción de competencia, reconocida en otras bacterias, y en particular condiciones presentes en el tracto gastrointestinal.

Evaluación de condiciones de inducción de la expresión génica del gen comX

Se estudió la expresión mediante qPCR utilizando el método del Ct, el gen 16S rRNA como control de expresión constitutiva, y los primers correspondientes que permiten la amplificación de los dos genes.

Se observa una inducción en expresión génica de un factor dos cuando las células fueron irradiadas con UV y ausencia de activación por hambreado y calentamiento a 50ºC (Figura 6).

fig6

Figura 6: Expresión de comX por qPCR. Las columnas indican la transcripción relativa entre las condiciones de inducción y control relativizado al gen 16S rRNA. Las barras muestran el desvío estándard de tres experimentos independientes.

Se analizaron las condiciones a las cuales los lactobacilos podrían ser sometidos en su hábitat, tracto gastrointestinal (TGI) (pH ácido - sales biliares y estrés salino) y también aquellas descriptas en otros organismos como inductoras de transformación natural (Exposición a luz UV, hambreado, calentamiento). Mediante la técnica de Dot Blot se determinó si las condiciones antes mencionadas permitían la expresión del gen comX (Figura 7)

fig7

Figura 7: Dot Blot de las condiciones evaluadas. C: control, H: hambreado, 30’’UV: exposición 30 segundos a luz UV, 60’’UV: exposición 60 segundos a luz UV, MRS N: MRS 0,45 M de NaCl, TGI: MRS pH 4 + 0,05% m/v de sales biliares. A la derecha, el control de la sonda biotinilada.

Tanto en la condición UV 30 y 60 segundos como en la condición TGI (MRS pH 4 + sales biliares 0.05% m/v) se observa un aumento en la expresión del gen comX comparada con la condición control donde la expresión estaría apagada.

Transferibilidad

Para evaluar si existía un aumento de la transferibilidad en las distintas condiciones de inducción, se realizó la transformación con un plásmido CmR (pNZ273) o DNA genómico conteniendo un determinante ErmR en contexto homólogo. Este plásmido, utilizado previamente en la cepa [29], es un plásmido replicativo en el que pudo evidenciarse la transformación mediante electroporación. A través del recuento por la técnica de número más probable (NMP) se verificó la adquisición de las resistencias. La técnica permite determinar eventos con baja representatividad.

ACA VA LA TABLA 1

Tabla 1: Tabla 1: Transferibilidad. Recuento de células transformadas con plásmido pNZ273 (CmR).2x108 UFC tratadas con las distintas condiciones de inducción de competencia y sin tratar (condición control) se pusieron en contacto con 1 µg de plásmido pNZ273 (CmR). Luego de 1 h a 37º C se agregó medio MRS y se realizaron diluciones seriadas al décimo inoculándose por triplicado las diluciones -1, -2 y -3 y sin diluir en medio MRS Cm [5µg/ml]. Como control de mutantes espontáneas se realizó el mismo procedimiento pero sin poner en contacto las células con el plásmido. El recuento se realizó por tabla mediante el método del número más probable

 Frecuencia de Transformantes CmR /Totales
Control6,5x10-8
Hambreado1,7 x10-8
30"UV1,4 x10-8
60"UV1,9x10-8
50°C1,1x10-8
MRS N1,3x10-8
TGI1,4x10-8

Del análisis de los resultados (Tabla 1) se desprende que ninguna de las condiciones indujo significativamente la competencia natural siendo la frecuencia obtenida similar a la de la condición control. Todas las condiciones generaron resultados del orden de los correspondientes a mutantes espontáneas preexistentes.

Trabajos realizados en S. thermophilus demostraron que la incorporación y recombinación de fragmentos de DNA lineales al genoma era posible si se flanqueaba la región a intercambiar por dos fragmentos de 1 kilobase de DNA con homología al genoma del huésped [30,31].

Para evaluar la incorporación de DNA lineal, hemos realizado los experimentos de inducción de estado de competencia con L. casei BL23 y posteriormente se utilizó como elemento a intercambiar el DNA total de L.casei BL71 [32], que porta en el genoma un cassette de resistencia a eritromicina en el mismo contexto genómico. En este caso, la frecuencia de las transformantes obtenida tampoco superó la frecuencia espontánea de mutación a ErmR.

Discusión

Los lactobacilos son capaces de sobrevivir al tracto gastrointestinal y colonizar transitoriamente nuestro intestino. En ese ambiente se enfrentan a múltiples condiciones de estrés. Para abordar la transferibilidad decidimos evaluar si esas condiciones son capaces de modificar la expresión genética de comX, anotado como un factor sigma alternativo de la polimerasa, que presenta similitud de secuencias con la proteína codificada para esa función en S. pneumoniae, bacteria con competencia natural reconocida.

Los resultados mostraron un incremento en la expresión de comX en las condiciones de radiación con UV y TGI (pH ácido con sales biliares). Sin embargo el número de colonias resistentes obtenidas en esas condiciones no fue significativamente diferente al de la condición de no inducción tal como se verificó por el NMP. A pesar de que hubo un aumento en la expresión de comX, ésta no fue suficiente para desarrollar competencia plena para la transformación con el plásmido o DNA genómico. En estudios con Lactococcus lactis y Lactobacillus sakei, solamente la sobreexpresión de comX permitió verificar un aumento en la expresión de los genes posteriores a la cascada de competencia sin embargo no pudieron obtener eventos de transformación [27, 33].

En L. sakei, Shmid y colaboradores [33] hallaron en el genoma secuenciado una probable secuencia codificante para un factor σH (sigH), ortólogo al de B. subtilis (característico regulador de procesos de inicio de esporulación como respuesta final al hambreado en bacterias esporulantes). Esta observación sugirió un vínculo entre los factores tipo σH y la competencia natural en no esporuladores, como el género Lactobacillus. Mediante un estudio de microarrays, observaron que la sobreexpresión del gen sigH de L. sakei activó genes relacionados con la competencia, sin embargo, aun así, no consiguieron detectar transformación genética.

En BL23 hemos encontrado también la codificación para genes con homología a las funciones comE y comG de Streptococcus, responsables de la toma y procesamiento del DNA [34], así como también funciones duplicadas del gen recA. Sin embargo no conseguimos transformación. Es importante señalar que la transformación requiere no solo del ingreso del DNA sino también de la activación de los sistemas de recombinación, donde RecA (y la activación del sistema SOS) son muy importantes para el éxito del proceso. Es notable que BL23 pese a contar con 4 profagos en su genoma, estos muestran una muy baja capacidad de inducción, incluso en condiciones de activación de la respuesta SOS (mitomicina) [35]. ¿Podrían estos profagos ser portadores de un sistema anti-SOS lo cual explicaría a la vez la baja transformabilidad y la baja inducción de los profagos? En B. subtilis una mutante del represor del profago Phi105 presenta justamente estas características de baja inducción y baja respuesta SOS comportándose como anti-SOS [36, 37].

Por otro lado, hoy sabemos que tanto las bacterias lácticas como los miembros de la microbiota intestinal poseen Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) y sus genes asociados y están significativamente representados en las Proteobacterias y los Firmicutes, especialmente los de importancia médica. [38- 41]. CRISPRs presentan una secuencia líder que contiene un promotor y una sucesión de repeticiones directas idénticas cortas (DRs de longitud 21 a 50 pb) separadas por secuencias únicas altamente variables denominadas espaciadores (20 a 84 pb). Este sistema hereditario, desempeña en bacterias hospedadoras un papel protector contra la invasión de plásmidos, fagos u otros fragmentos de DNA. Los espaciadores son secuencias capturadas de fagos, plásmidos u otros; también son elementos clave de la inmunidad adaptativa, ya que almacenan la "memoria" de los encuentros de un organismo con elementos genéticos móviles específicos adquiridos como resultado de una infección anterior sin éxito. Esta memoria permite el reconocimiento y la neutralización de los invasores sobre las infecciones subsiguientes a pesar de la frecuente transferencia horizontal de genes de CRISPR-cas loci [42].

Estos resultados argumentan a favor del hecho que los lactobacilos no serían capaces de transformarse en este ambiente natural. Estas cepas tienen el potencial de servir como huéspedes de genes de resistencia a los antibióticos, con el riesgo de transferir estos genes a otras bacterias. Nosotros consideramos que la resistencia a los antibióticos transferibles es la única causa relevante de precaución y justifica la realización de ensayos de susceptibilidad a los antibióticos. Sin embargo la resistencia intrínseca y resistencia debida a la mutación de genes cromosómicos presentan un bajo riesgo de diseminación horizontal, y tales cepas deben ser aceptadas para el consumo de alimentos. La transferencia horizontal de genes permite a un organismo competir efectivamente en un nuevo entorno. En un entorno siempre cambiante como el tracto gastrointestinal, se puede especular que la introducción de nuevos organismos como los probióticos puede eventualmente conducir a la adquisición o pérdida de funciones específicas. Afortunadamente, las tendencias universales indican que la recombinación entre especies disminuye exponencialmente con la divergencia de secuencias [43].

La microbiota del intestino humano es uno de los ecosistemas microbianos más complicados del cuerpo humano y tiene importantes asociaciones con la salud humana. El análisis computacional de la composición de CRISPR basado en los datos de secuenciación de metagenoma es factible. Proporciona un enfoque eficiente para encontrar nuevas matrices CRISPR potenciales y para analizar el ecosistema y la historia de los microbiomas humanos [44]. Ese tipo de estudio puede demostrar que en el microbioma gastrointestinal la inmunización mediante la adquisición de espaciadores CRISPR-cas loci permite una forma única de evolución mediante la cual una población no sólo adquiere rápidamente resistencia a sus depredadores, sino que también pasa este mecanismo de resistencia verticalmente a su progenie y horizontalmente a sus cohabitantes [45, 46]. Este dato seria crucial en el proceso de aceptación del uso microorganismos genéticamente modificados en alimentos que a la fecha se enfrentan a baja aceptación pública y un riguroso escrutinio regulatorio.

Referencias:

1. Saxelin M, Tynkkynen S, Mattila-Sandholm T, de Vos WMr (2005) Probiotic and other functional microbes: from markets to mechanisms Current Opinion Biotechnology 2 16: 204–211.

2.De Moreno de LeBlanc A, Matar C, Perdigón G (2007) The application of probiotics in cancer British Journal of Nutrition 98 Suppl 1:S105-110.

3.Galdeano MC, de Moreno de LeBlanc A, Vinderola G, Bibas Bonet M, Perdigón G (2009) Proposed model: mechanisms of immunomodulation induced by probiotic bacteria Clinical and vaccine immunology 14: 485-492.

4. Ng SC, Hart AL, Kamm MA, Stagg AJ, Knight SC (2009) Mechanisms of action of probiotics: recent advances Inflammatory bowel diseases 15 (2):300-10.

5. Kawase M, He F, Kubota A, Harata G, Hiramatsu M (2010) Oral administration of lactobacilli from human intestinal tract protects mice against influenza virus infection Letters in applied microbiology 51(1):6-10.

6. Horinaka M, Yoshida T, Kishi A, Akatani K, Yasuda T, Kouhara J, Wakada M, Sakai T (2010) Lactobacillus strains induce TRAIL production and facilitate natural killer activity against cancer cells FEBS Letters 584(3):577-82

7. Sutula J, Coulthwaite LA, Thomas LV, Verran J (2013) The effect of a commercial probiotic drink containing Lactobacillus casei strain Shirota on oral health in healthy dentate people Microbial Ecology in Health and Disease Oct 29; 24. doi: 10.3402/mehd.v24i0.21003.

8. Prado Acosta M, Palomino MM, Allievi MC, Sanchez Rivas C, Ruzal SM (2008) Murein hydrolase activity in the surface layer of Lactobacillus acidophilus ATCC 4356 Applied and Environmental Microbiology, 74(24), 7824-7827.

9. Prado Acosta M, Ruzal SM, Allievi MC, Palomino MM, Sanchez Rivas C (2010) Synergistic effects of the Lactobacillus acidophilus surface layer and nisin on bacterial growth. Applied and Environmental Microbiology,76(3), 974-977.

10. Prado Acosta M, Ruzal SM, Cordo SM. (2016) S-layer proteins from Lactobacillus sp. inhibit bacterial infection by blockage of DC-SIGN cell receptor. International Journal of Biological Macromolecules,92, 998-1005

11. Martínez MG, Prado Acosta M, Candurra NA, Ruzal SM (2012) S-layer proteins of Lactobacillus acidophilus inhibits JUNV infection Biochemical and Biophysical Research Communications,422(4), 590-595.

12. Konings WN, Kok J, Kuipers OP, Poolman B (2000) Lactic acid bacteria: the bugs of the new millennium Current Opinion Microbiology 2000 Jun;3(3):276-82.

13. Rochat T, Bermúdez-Humarán L, Gratadoux JJ, Fourage C, Hoebler C, Corthier G, Langella P (2007) Anti-inflammatory effects of Lactobacillus casei BL23 producing or not a manganese-dependent catalase on DSS induced colitis in mice Microbial Cell Factories 6:22–31.

14. Mazé A, Boël G, Zúñiga M, Bourand A, Loux V, Yebra MJ, Monedero V, Correia K, Jacques N, Beaufils S, Poncet S, Joyet P, Milohanic E, Casarégola S, Auffray Y,Pérez-Martínez G, Gibrat JF, Zagorec M, Francke C, Hartke A, Deutscher J (2010) Complete genome sequence of the probiotic Lactobacillus casei strain BL23. Journal of Bacteriology. 192:2647-8.

15. Mayo B, van Sinderen D, Ventura M (2008) Genome analysis of food grade lactic Acid-producing bacteria: from basics to applications Current Genomics May;9(3):169-83.

16. Klaenhammer TR, Altermann E, Pfeiler E, Buck BL, Goh YJ, O'Flaherty S,Barrangou R, Duong T (2008) Functional genomics of probiotic Lactobacilli Journal of Clinical Gastroenterology 42 Suppl 3 Pt 2:S160-2.

17. Kant R, Blom J, Palva A, Siezen RJ, de Vos WM (2011) Comparative genomics of Lactobacillus Microbial Biotechnology 4(3):323-332.

18. Altermann E, Klaenhammer TR (2011) Group-specific comparison of four lactobacilli isolated from human sources using differential blast analysis Genes & Nutrition 6(3):319-40.

19. Borriello SP, Hammes WP, Holzapfel W, Marteau P, Schrezenmeir J, Vaara M, Valtonen V (2003) Safety of probiotics that contain lactobacilli or bifidobacteria Clinical Infectious Diseases 15;36(6):775-80.

20. Dicks LMT, Botes M (2010). Probiotic lactic acid bacteria in the gastro-intestinal tract: Health benefits, safety and mode of action Beneficial Microbes, 1(1), 11–29. https://doi.org/10.3920/BM2009.0012

21. Mathur S, Singh R (2005) Antibiotic resistance in food lactic acid bacteria--a review International journal of food microbiology 15;105(3):281-95.

22. Danielsen M, Wind A (2003) Susceptibility of Lactobacillus spp. to antimicrobial agents. International Journal of Food Microbiology 82(1):1-11.

23. Leisner M, Stingl K, Frey E, Maier B (2008) Stochastic switching to competence Current Opinion in Microbiology 11(6):553-9.

24. Claverys JP, Prudhomme M, Martin B (2006) Induction of competence regulons as a general response to stress in gram-positive bacteria Annual Review of Microbiology 60:451-75.

25. Cutting SM, Harwood CR (1990) Molecular biological methods for Bacillus. Wiley

26. Blomqvist T, Steinmoen H, Håvarstein LS (2006) Natural genetic transformation: A novel tool for efficient genetic engineering of the dairy bacterium Streptococcus thermophilus Applied and Environmental Microbiology 72(10):6751-6.

27. Wydau S, Dervyn R, Anba J, Dusko Ehrlich S, Maguin E (2006) Conservation of key elements of natural competence in Lactococcus lactis ssp FEMS Microbiology Letters 257(1):32-42.

28. Palomino MM, Allievi MC, Gründling A, Sanchez-Rivas C, Ruzal SM (2013). Osmotic stress adaptation in Lactobacillus casei BL23 leads to structural changes in the cell wall polymer lipoteichoic acid Microbiology 159(11), 2416-2426.

29. Palomino MM, Allievi MC, Prado-Acosta M, Sanchez-Rivas C, Ruzal SM (2010). New method for lectroporation of Lactobacillus species grown in high salt Journal of Microbiological Methods, 83(2), 164-167.

30. Lecomte X, Gagnaire V, Lortal S, Dary A, Genay M (2016) Streptococcus thermophilus, an emerging and promising tool for heterologous expression: Advantages and future trends Food Microbiology;53(Pt A):2-9. doi: 10.1016/j.fm.2015.05.003.

31. Fontaine L, Dandoy, D, Boutry C, Delplace B, De Frahan MH, Fremaux C, Horvath P, Boyaval P, Hols P (2010). Development of a versatile procedure based on natural transformation for marker-free targeted genetic modification in Streptococcus thermophilus Applied and Environmental Microbiology. 76, 7870e7877.

32. Monedero V, Gosalbes MJ, Pérez-Martínez G (1997) Catabolite repression in Lactobacillus casei ATCC 393 is mediated by CcpA Journal of Bacteriology 179, 6657–6664

33. Schmid S, Bevilacqua C, Crutz-Le Coq AM (2012). Alternative sigma factor σ H activates competence gene expression in Lactobacillus sakei. BMC microbiology 12(1), 32.

34. Martin B, Quentin Y, Fichant G, Claverys JP (2006) Independent evolution of competence regulatory cascades in streptococci? Trends Microbiology 14(8):339-45.

35. Dieterle ME, Fina Martin J, Durán R, Nemirovsky SI, Sanchez Rivas C, Bowman C, Russell D, Hatfull GF, Cambillau C, Piuri M (2016) Characterization of prophages containing "evolved" Dit/Tal modules in the genome of Lactobacillus casei BL23 Applied Microbiology and Biotechnology,100(21), 9201-9215.

36. Rubinstein CP, Coso OA, Ruzal S, Sanchez-Rivas C (1993) Anti-SOS effects induced in Bacillus subtilis by a ϕ105 mutant prophage Archives of Microbiology,160(6), 486-491.

37. Rubinstein CP, Guerchicoff A, Sanchez-Rivas C (1998) Normal induction of the SOS response in Bacillus subtilis is prevented by the mutant repressor from phage phi 105cts23 FEMS Microbiology Letters,167(2), 315-320.

38. Godde JS, Bickerton A. (2006). The repetitive DNA elements called CRISPRs and their associated genes: Evidence of horizontal transfer among prokaryotes. Journal of Molecular Evolution, 62(6), 718–729. https://doi.org/10.1007/s00239-005-0223-z

39. Horvath P, Coûté-Monvoisin AC, Romero DA, Boyaval P, Fremaux C, Barrangou R (2009). Comparative analysis of CRISPR loci in lactic acid bacteria genomes International Journal of Food Microbiology, 131(1), 62–70. https://doi.org/10.1016/j.ijfoodmicro.2008.05.030

40. Makarova KS, Wolf YI, Alkhnbashi OS, Costa F, Shah SA, Saunders SJ, Koonin EV (2015). An updated evolutionary classification of CRISPR-Cas systems Nature Reviews. Microbiology, 13(11), 722–736. https://doi.org/10.1038/nrmicro3569

41. Marraffini LA (2015). CRISPR-Cas immunity in prokaryotes Nature, 526(7571), 55–61. https://doi.org/10.1038/nature15386

42. Mohanraju P, Makarova KS, Zetsche B, Zhang F, Koonin EV, Van der Oost J (2016). Diverse evolutionary roots and mechanistic variations of the CRISPR-Cas system. Science, 353(6299), aad5147. https://doi.org/10.1126/science.aad5147

43. Majewski J, Zawadzki P, Pickerill P, Cohan FM, Dowson CG (2000). Barriers to genetic exchange between bacterial species: Streptococcus pneumoniae transformation Journal of Bacteriology 182(4), 1016-1023

44. Mangericao TC, Peng Z, Zhang X (2016) Computational prediction of CRISPR cassettes in gut metagenome samples from Chinese type-2 diabetic patients and healthy controls BMC Systems Biology, 10(S1), 5.

45. Stout E, Klaenhammer TR, Barrangou R (2017). CRISPR-Cas Technologies and Applications in Food Bacteria Annual Review of Food Science and Technology, 8(1).

46. Araos R, Tai AK, Snyder GM, Blaser MJ, D'agata EM (2016) Predominance of Lactobacillus spp. among patients who do not acquire multidrug-resistant organisms Clinical Infectious Diseases, ciw426. 




ISSN 1666-7948
www.quimicaviva.qb.fcen.uba.ar

Revista QuímicaViva
Número 2, año 14, Abril 2017
quimicaviva@qb.fcen.uba.ar